Eteplirsen fda briefing book

Eteplirsen is a morpholino phosphorodiamidate antisense oligomer. Please accept sareptas new drug application nda for eteplirsen. The food and drug administration approved a muscular dystrophy drug despite deeply flawed evidence. Eteplirsen is an exonskipping drug that targets a section of dna called exon 51, and may help up to percent of duchenne muscular dystrophy dmd patients. Sareptas stock soars premarket as fda news fuels hope for. Fda approval of eteplirsen for muscular dystrophy jama. This is a direct turnaround from the fdas position just three months ago. The book should be approximately 20 to 30 pages long, and should be organized in a way that complements the sponsors oral presentations. Deflazacort, eteplirsen, and golodirsen for duchenne. Duchenne moms say fda documents widen the divide between. Longitudinal effect of eteplirsen versus historical. These are my opinions about the drug approval and do not reflect the companys positions. Food and drug administration 10903 new hampshire avenue silver spring, md 20993 1888infofda 18884636332 contact fda. Families affected by duchenne gave emotional testimonies at fdas advisory meeting for eteplirsen.

Fda urged to approve sarepta dmd drug by dozens of medical. Dear fda, i am writing to you about the forthcoming meeting to consider the marketing application for eteplirsen, a morpholinooligo that induces exonskipping to. Eteplirsen granted fda accelerated approval lgm pharma. It is the sponsors responsibility to prepare an fda briefing book. After four years of weekly infusions of eteplirsen, the boys in sareptas study could walk on average 162 meters further almost two football fields than the boys in italy and belgium. Fda accepts sarepta nda for eteplirsen to treat dmd.

Fda extends decision deadline date for eteplirsen to may. The fda on thursday rejected an experimental drug for duchenne muscular dystrophy from biomarin pharmaceutical, a decision that doesnt necessarily come as a surprise given the harsh criticism. To speed trials, companies can evaluate a drugs effect on a surrogate or substitute endpoint. Fda approves first drug to treat duchenne muscular dystrophy. Fda rejects biomarins duchenne drug, sarepta up next. This critical document is the companys opportunity to provide the agency with all essential facts about the product.

Heres why sarepta therapeutics shares rebounded in february. This despite the urging of congress to fast track such drugs through the fda via the food and drug safety and innovation act fdasia passed in 2012. The fda says its hoping for more information about how and whether eteplirsen works. This move could mean bad news for sareptas application for its duchenne muscular dystrophy drug eteplirsen. Exondys 51 is specifically indicated for patients who have a confirmed mutation of the dystrophin gene amenable to exon 51 skipping, which affects about percent of the population with dmd. However, the accelerated approval pathway through which eteplirsen was authorized requires that a surrogate end point must be reasonably likely to predict clinical benefit of the drug, 6 and this. Eteplirsen is approved by an unprecdented decision by the fda. Exondys 51 eteplirsen dose, indications, adverse effects. Food and drug administration today approved exondys 51 eteplirsen injection, the first drug approved to treat patients with duchenne muscular dystrophy dmd. Sarepta sinks as fda changes investigational drug process. The device has four patents listed in the orange book, which do not. Exondys 51 is specifically indicated for patients who have a confirmed mutation of the dystrophin gene amenable to exon 51 skipping, which affects about percent of the. Eteplirsen approval seen as marking new direction at fda. Eteplirsen represents another case in which the fda used a surrogate measure in this case muscle dystrophin levels as the basis for approval.

Fda staff criticizes duchenne drug data medpage today. The us food and drug administration fda has approved its first drug to treat duchenne muscular dystrophy, largely on the basis of data from a trial in only 12 boys. The fda is under fire by the rare disease community for recently denying the new drug application of bio marins drug, kyndrisa, a similar drug as eteplirsen. Oligo complement ctagaaatgccatcttccttgatgttggag dmd001 exon 51, enst00000357033. Eteplirsen is designed to bind to exon 51 of dystrophin premessenger rna mrna, resulting in exclusion of this exon during mrna processing, which allows for the production of an internally truncated dystrophin protein. Please accept sareptas new drug application nda for. Eteplirsen granted accelerated approval to treat dmd. Fda new drugs director slams sarepta approval as not a. Sareptas eteplirsen approved after contentious internal fda debate.

Sarepta therapeutics announces fda advisory committee. Fda commissioner calls for sarepta drug study to be retracted. I am an employee of bristolmyers squibb which is developing drugs for duchenne muscular dystrophy and is a competitor of sarepta. Us fda eteplirsen briefing document nda 206488, 30mer, 20% g, 43% cg, predicted tm. Preparing for an fda advisory committee meeting mddi online. John jenkins, who runs the fdas office for new meds, has not taken kindly to the regulators recent, and highly controversial, approval of sareptas duchenne med exondys 51 eteplirsen. Food and drug administration fda has accepted its new drug application nda for eteplirsen to treat duchenne muscular dystrophy dmd. Eteplirsen, drisapersen, the fda and dedicated duchenne moms. Studies in ambulatory patients with duchenne have demonstrated that treatment with exondys 51 also known as eteplirsen yielded stabilization of measures of pulmonary function including percentage maximum inspiratory pressure % mip and percentage maximum expiratory pressure % mep.

Intravenous administration of eteplirsen 0, 100, 300, or 900 mgkg to juvenile male rats once weekly for 10 weeks beginning on postnatal day 14 resulted in renal tubular necrosis at the highest dose tested and decreased bone densitometry parameters mineral density, mineral. Its designed to help only about percent of duchenne muscular dystrophy patients. Duchenne experts encourage fda to approve eteplirsen. Fda briefing document peripheral and central nervous system drugs advisory committee meeting. Implications of the fda approval of eteplirsen for. Fda evaluated eteplirsen under an accelerated approval process that allows much leeway. Eteplirsen is designated an orphan drug by the fda for treatment of duchenne muscular dystrophy.

Data sources include ibm watson micromedex updated 10 apr 2020, cerner multum updated 6 apr 2020, wolters kluwer updated. Pcnsd advisory committee meeting briefing document. The attached package contains background information prepared by the food and drug administration fda for the panel members of the advisory committee. Briefing memo for new drug application nda 206488, for the use of eteplirsen for the treatment of duchenne muscular dystrophy in patients. Decades of mda research and investment have paid off with the first diseasemodifying drug available to treat dmd. To the editor drs kesselheim and avorn raised concerns about the approval by the us food and drug administration fda of eteplirsen to treat duchenne muscular dystrophy dmd, such as reliance of the pivotal study on a surrogate measure. Us government approves controversial drug for muscular. Congratulations to the race to yes organizers tracy seckler, jenn mcnary, christine mcsherry, mindy leffler, and many others and the duchenne community for their passionate and successful campaign to petition the white house to urge the food and drug administration fda to use the accelerated approval pathway for approval and. This material is provided for educational purposes only and is not intended for medical advice, diagnosis or treatment. Exondys 51 contains eteplirsen and is the first fda approved drug for dmd. Heres why sarepta therapeutics shares rebounded in.

Food and drug administration yesterday approved exondys 51 eteplirsen injection, the first drug approved to treat patients with duchenne muscular dystrophy dmd. On april 26, an fda advisory committee voted 76 that the exonskipping drug eteplirsen for duchenne muscular dystrophy dmd failed to meet the standards needed for accelerated approval. Thirtysix experts in the field of duchenne muscular dystrophy have signed a letter to the fda saying that, based on existing scientific data, the agency should approve eteplirsen sarepta therapeutics, which is awaiting a final verdict. Included in this briefing package are an integrated.